SARS-CoV-2 y los postulados de Koch

Está siendo fuente de debate si está o no científicamente demostrada la existencia del SARS-CoV-2 o si cumple los postulados de Koch, que explicaban la relación entre microorganismos y enfermedades. Los elaboró en el siglo XIX el médico y microbiólogo Robert Koch. Son cuatro y se pueden resumir de la siguiente forma:

  1. Un agente patógeno debe estar presente en los pacientes enfermos, pero no en personas sanas.
  2. A partir de un enfermo, el patógeno debe poder ser aislado y purificado en placas de cultivos celulares.
  3. La introducción del patógeno en una persona sana debe producir una enfermedad igual a aquella que sufría el paciente del que se extrajo el patógeno.
  4. Finalmente, si analizamos al nuevo enfermo, debe presentar exactamente el mismo patógeno.

Se está poniendo en duda la existencia del SARS-CoV-2 diciendo que la propia Organización Mundial de la Salud y los Centros para el Control de Enfermedades han expresado que el virus no cumple estos postulados. Uno de los argumentos utilizados provienen de este artículo, que identificó, en enero de 2020, al agente causante de unas neumonías atípicas en Wuhan. En él, se dice explícitamente: “Aunque nuestro estudio no cumple con todos los postulados de Koch, nuestros análisis evidencian la implicación del virus en el brote de Wuhan“. Analicemos esto en detalle.

Photo by Pixabay on

¿Por qué los investigadores dijeron que su estudio no cumplía con los postulados de Koch? Porque lo que hicieron fue analizar muestras de algunos pacientes con neumonía, aislaron un virus en cultivos celulares, secuenciaron su genoma y vieron que pertenecía a la familia de los coronavirus. Lo nombraron inicialmente 2019-nCoV, término que acabó sustituyéndose por el de SARS-CoV-2 más adelante. La prudencia científica los llevó a escribir esa frase, dado que hacía falta más experimentos que confirmasen que todos los pacientes de Wuhan con neumonía tenían el coronavirus. Y, además sería necesario tomar una muestra de virus, inocularla en un animal sano, observar la misma neumonía y el mismo virus para que se cumplieran todos los postulados. Sin embargo, en ese momento no se disponía de animales de experimentación como para llevar a cabo dichos estudios.

En cambio, todos estos experimentos sí se han llevado a cabo en hámsters más adelante. En este artículo podemos leer lo siguiente: “Se han satisfecho todos los postulados de Koch, reproduciéndose los cambios clínicos y patológicos tras la infección con el virus y recogida de muestra viral“. Pero no sólo eso, sino que hay cientos de artículos donde se ha aislado, purificado y secuenciado el virus, por todo el mundo. Incluso se han construido copias sintéticas del virus a partir del genoma. Por lo tanto, pese a que los primeros estudios al respecto no pudieran comprobar los postulados, actualmente no existe duda científica alguna de que el virus existe y cumple los postulados de Koch.

Photo by Edward Jenner on

Sin embargo, hay quien afirma que el virus no cumple dichos postulados por la existencia de los asintomáticos, es decir, gente sana que sí tiene el virus. Esto iría en contra del primer postulado, que afirma que el patógeno sólo puede encontrarse en los enfermos, nunca en los sanos. Uno podría pensar que, si el sano y el enfermo dan positivo es porque los tests fallan, pero la realidad es que la técnica de PCR tiene un altísimo porcentaje de acierto (entre un 91% y 98%). Otra explicación sería que el origen de la enfermedad no es el virus. Esta controversia también se ha utilizado para poner en duda la existencia del SARS-CoV-2. Las claves son la carga viral, así como ciertas características de la persona infectada, como la edad y patologías previas.

Los asintomáticos dan positivo al test PCR, al igual que los enfermos, porque este test no cuantifica la cantidad de virus dentro del organismo. Para eso se utilizan otras técnicas cuantitativas. ¿Significa esto que el primer postulado es falso? No. Robert Koch, en el siglo XIX, no podía encontrar restos de microorganismo en pacientes si los niveles de infección eran muy bajos porque no disponía de las técnicas de Biología Molecular como para ello. Y elaboró sus postulados en base a eso.

Hoy en día, sabemos que convivimos con múltiples patógenos en nuestro organismo sin sufrir la enfermedad que producen. Se denominan patógenos oportunistas, dado que aprovechan una bajada de nuestro sistema inmunitario para extenderse y originar una enfermedad. Por ejemplo, estando sanos, podríamos hacernos un test PCR para detectar al hongo Candida albicans y dar positivo, pero no por ello sufrimos una candidiasis. Detectar la presencia de un microorganismo patógeno no es sinónimo de que se produzca la enfermedad. Y, de forma recíproca, la ausencia de enfermedad no implica la ausencia del microorganismo.

36 comentarios sobre “SARS-CoV-2 y los postulados de Koch

  1. Un artículo muy interesante Javier, pero tengo una pregunta, cuando dices:

    “Sin embargo, en ese momento no se disponía de animales de experimentación como para llevar a cabo dichos estudios”.

    ¿Cómo es posible algo así cuando tienen recursos de sobra?

    ¿O tienen que ser unos animales en concreto que son difíciles de encontrar?

    Es lo que no me ha quedado claro de tu artículo, el resto está fantástico.

    Saludos desde Santander.

    Me gusta

    1. Saludos. A comienzos de la pandemia, con el virus recién descubierto apenas había dado tiempo a diseñar y generar animales susceptibles a la infección que desarrollen bien la enfermedad. Es un paso que, en algunos casos, se tarda un año o incluso más. La urgencia de la pandemia, unido a que se conocían animales para otros coronavirus, aceleró el proceso y, en cuestión de meses, ya se hicieron los primeros experimentos. ¡Un saludo!

      Me gusta

  2. Buenas noches,

    aún no me ha quedado muy claro con los asintomáticos y el primer postulado. ¿Sería la excepción que confirma la regla o habría que revisar esos postulados?.

    Un saludo

    Me gusta

    1. Asintomáticos significa que no se aprecia, a simple vista, que tenga algún síntoma. Sin embargo, es posible hacerle una Tomografía Computarizada al enfermo asintomático y es muy posible que se detecte la neumonía en uno o ambos los pulmones. ¿Está sano el paciente por no tener síntomas? Claro que no, es solo que no presenta ningún síntoma. El Covid-19 no es la única enfermedad que tiene asintomáticos. Hay muchísimas enfermedades, muy terribles, que son asintomáticas y que por casualidad la detectan, verbi gratia, cuando ya es demasiado tarde y el paciente ya está muriendo. El asintomático puede estar tanto sano como enfermo, pero de ninguna manera puede ser “inmune” como se ha dicho por ahí, ya que eso implicaría que tienes defensas muy específicas contra el virus que lo neutralizarían ni bien ingresar al organismo. No pasa así en el asintomático, donde el virus a comenzado a replicarse y a diseminarse por la sangre de todos los sistemas del cuerpo (viremia).

      Me gusta

      1. Buenas, esta bien que haya sitios donde se pueda leer ciencia sin entrar en conspiraciones. Es una pena que haya que estar explicando todo esto de una manera tan especifica por el hecho de que exista gente que manipula los datos sin conocimiento para soltar cuatro tonterías y quedarse tan ancho…. llegue a ti tras un comentario en un video donde se afirmaba que el virus no existe (no probadamente al menos…) y que no cumplia con los postulados de Koch… lo que hay que leer…

        Dicho esto, quería comentarte (en mi opinion…) que la barrera entre un inmune y un asintomático es muy fina. Una persona asintomática que nunca desarrolla síntomas es básicamente una persona inmune. Su cuerpo, por las razones que sean le han protegido de desarrollar la enfermedad (como cuando te inmunizan mediante una vacuna…. te infectas, el virus se replica, pero tu sistema inmune lo para a tiempo = inmune). Otra cosa es que se detecte el el virus en el periodo asintomático,… esa persona desarrolla la enfermedad, solo que cuando se le midió si tenia o no tenia el virus si lo tenia y sin síntomas (aun).

        Creo que se mezcla mucho la terminología inmune, asintomático, pcr, etc etc. Pero la gente no conoce como funciona la biología del virus. Al final solo deberían llamarse asintomáticos a los inmunes, que por una razón u otra (inmunidad innata privilegiada, adquirida por casualidad durante la maduración de los linfocitos, inmunidad cruzada por otro virus, o incluso que tengan los famosos receptores diferentes y el virus simplemente no pueda entrar – este si seria un superinmune jeje) no desarrollen ningún tipo de sintomatología o que esta sea realmente leve.

        No sé si tienes una opinion diferente al respecto, pero esta bien abrir debates constructivos! 😉

        Un saludo

        Me gusta

        1. Hola FJ

          Segun tu criterio para que una persona sea calificada de asintomatica ha de estar previamente infectada por el virus? O como asintomatico tambien catalogarias a una persona no infectada con el virus y que no presente sintomas.

          un cordial saludo

          Me gusta

          1. Hola Daniel,
            si nos ponemos estrictos, asintomático es “sin síntomas”. Eso incluiría (estrictamente hablando…) a todos los que no muestren síntomas (infectados o no infectados).

            Pero en medicina, el termino asintomático solo hace referencia a aquellas personas que estando infectadas no presentan síntomas, ya sea porque sean inmunes y eliminen el virus antes de que la enfermedad progrese a un nivel sintomático, o porque están en etapas tempranas de la infección donde los síntomas aun no se han manifestado. No se si esto contesta a tu pregunta…

            Un saludo!

            Me gusta

  3. Hola

    Gracias por tu trabajo divulgador. En tu articulo mencionas: “Uno de los argumentos utilizados provienen de este artículo, que identificó, en febrero de este 2020, al agente causante de unas neumonías atípicas en Wuhan.” La pregunta que nos hacemos muchos y quiza tu dispongas del conocimiento adquirido para aclararla es si este virus se identifico de la manera correcta. si en Efecto se purifico en su totalidad o si bien simplemente se encontraron partes de su genoma y estas se completaron con el uso de un sistema informatico para obtener la secuenciacion completa del genoma del virus.

    Un cordial saludo y gracias de nuevo

    Me gusta

    1. Saludos y gracias por tus palabras. He escrito un nuevo artículo que responde tus preguntas. Los investigadores hicieron ambas cosas. Purificaron virus y hay fotografías de él a miscroscopio electrónico; y además lo secuenciaron. Para esto segundo te recomiendo que entres y lo leas aquí: Básicamente, sí se realizan múltiples PCR para amplificar fragmentos pequeños y, a partir de ellos, se “monta” el genoma. Es exactamente lo mismo que se hizo en su día, por ejemplo, en el Proyecto Genoma Humano. Es lo habitual para estos casos. Un saludo.

      Me gusta

      1. Hola Javier y muchas gracias, me lo he leido y es de agradecer. Tambien he leido el articulo del New England Journal Medical , ( el original a que hace referencia en el tuyo y segun tengo entendido el que la OMS acredita como el documeto medico que certifica la existencia del virus SARS-COV-2.

        Una de las cosas que es cuanto menos llamativa es que en el Articulo del NEJM esque los propios investigadores en su articulo indican: “Although our study does not fulfill Koch’s postulates, our analyses provide evidence implicating 2019-nCoV in the Wuhan outbreak. ” o dicho de otra manera reconocen en el mismo articulo que no han seguido los postulados de Koch sin embargo en tu articulo indicas que se han seguido los postulados de Koch. Quiza sea el caso de que en otros estudios y de manera individual se hayan considerado estos postulados peron en el NEJM aceptado como referencia por la OMS no se hizo.

        Tambien resulta significativo que en el articulo indican sin lugar a dudas lo siguiente sobre el proceso de aislmiento y deteccion del virus:

        “To determine whether virus particles could be visualized in 2019-nCoV–infected human airway epithelial cells, mock-infected and 2019-nCoV–infected human airway epithelial cultures were examined with light microscopy daily and with transmission electron microscopy 6 days after inoculation. Cytopathic effects were observed 96 hours after inoculation on surface layers of human airway epithelial cells; a lack of cilium beating was seen with light microcopy in the center of the focus (Figure 2)”

        Siendo la “Figure 2” fotografia de microscopio electronico la cual no muestra el virus sino celulas con respuesta citopatica.

        La “figure 3” si muestra una fotografia electronica de particulas que por morfologia podrian pertenecer a la familia de los coronavirus “his observed morphology is consistent with the Coronaviridae family.”

        Pero ninguna de estas pruebas por si misma realmente confirman la aparicion de un nuevo virus. Tal y como lo veo tenemos una coleccion de pruebas que apuntan a la aparicion de un nuevo virus pero ninguna es concluyente. La suma de todas ellas tampoco es concluyente pero se ha decido aceptar que hay un nuevo virus. En mi opinion no es concluyente pero si muy convincente, de hecho yo creo que el SARS-COV-2 (o dicho de una manera un nuevo coronavirus que esta afectando al ser humano) existe.

        Lo que da mucha desconfianza es que despues del grandisimo impacto que ha tenido a nivel mundial se sigua utilizando un estudio creado en China por cientificos Chinos en el cual solo se analizaron a 7 pacientes y de estos 7 solo en tres se dijo encontrar este virus. No parece una muestra poblacional extremadamente pequena para un estudio de esta relevancia? No deberia de haberse hecho y publicado por muchisimos mas cientificos de diversos paises un estudio de las mismas caracteristicas en el cual se intentase purificar y secuenciar el virus desde cero sin usar como gold standard las cadenas de genomas publicadas por este grupo de cientificos chinos?

        Muchas gracias de nuevo por haber respondido y mantener el debate abierto y la divulgacion que va con el

        Un cordial saludo

        Me gusta

        1. Saludos. La verdad es que no esperaba tener debates tan interesantes cuando abrí la web. Te respondo por partes.
          La OMS habrá elegido este artículo de la NEJM como aquel en el que se descubrió el coronavirus, eso me parece correcto. Efectivamente, en el mismo momento en que se descubre un virus es dificil comprobar los postulados de Koch. Esto ocurre, como indicaba en el artículo, porque hacen falta animales de experimentación. Eso se hizo con hámsters en el segundo artículo que comento aquí:, así como en alguno otro en el que se estudian ratones. El hecho de que cuando se descubrió el virus no se pudiera comprobar si dicho virus cumple o no los postulados es normal por esta razón.
          Sobre la figura 2. Según indican los autores muestra el llamado “efecto citopático”. Visto en campo claro cuesta más entenderlo si no estás familiarizado con estas técnicas. Si te fijas bien en la figura, la foto de la derecha tiene señalado una zona redondeada más clara, signo de que las células se han muerto y se han levantado de la placa. Este era el primer paso antes de realizar las fotografías con microscopía electrónica, que son más costosas de conseguir. Por eso se muestra primero esto en la figura 2 y, luego, en la figura 3 se ve el virus. Para ampliar por qué todo esto demuestra que se ha descubierto un virus nuevo, te recomiendo que leas un artículo donde lo explico mejor:
          El trabajo para obtener, purificar y observar partículas virales de coronavirus es demasiado costoso como para hacerlo a cada paciente sospechoso. Se utiliza siempre PCR para ello. No obstante, no pienses que la comunidad científica se basa en ese estudio sin más. La parte de identificar y secuenciar el genoma del SARS-CoV-2 en pacientes sí se ha hecho miles de veces. Existe lo que llamamos “secuencia consenso” que es la más conservada entre los pacientes estudiados, pero puedes acceder a la secuencia completa de miles de aislados virales aquí: En concreto, más de 8600 personas en las que se ha conseguido secuenciar el genoma de este coronavirus.
          ¡Un saludo!

          Me gusta

          1. Hola de nuevo y muchisimas gracias por mantener el debate abierto. Lo que comentas sobre los postulados de Koch en mi opinion tiene mucha logica y hasta cierto punto veo entendible que publicaran este estudio sin haber incluido la realizacion de los postulados en el mismo desde el punto de vista de la urgencia del momento.

            la secuenciacion por consenso es la unica parte que no veo cerrada del todo (el cabo suelto aun por atar a mi modo de ver/en mi cabeza). En concreto la parte que juega el programa informatico que no tengo claro si simplemente reordena las pequenas cadenas de genomas identificadas para crear asi la cadena entera del SARS COV 2 o si bien ademas de ordenarlas incluye/inventa alguna de estas pequenas cadenas para de esta manera poder completar dicho genoma en su totalidad.

            Sabrias donde poder consultar esta duda?

            un cordial saludo

            Me gusta

          2. Te contesto por aquí. Todo un placer participar de este tipo de debates. Sobre la secuencia consenso, el software bioinformático no rellena huecos, eso no tendría sentido. El ordenador no puede suponer nucleótidos. Imagina que cada lectura es como un ficha de dominó. El final de la primera lectura debe coincidir con el principio de la siguiente de una forma significativa. Pongo un ejemplo un poco burdo:
            – Lectura 1: AAATTTGG
            – Lectura 2: ATTTGGGA
            – Lectura 3: TGGGAACCC
            – Lectura 4: ACCCTATATA
            – Secuencia completa: AAATTTGGGTGGGAACCCTATATA

            ¿Ves el patrón? El programa compara el principio y el final de cada lectura para darle un sentido. Aquí tienes otro ejemplo más realista de cómo se “alinean” las lecturas (o reads, en inglés) para conocer la secuencia completa:

            Te dejo un par de links por si quieres curiosear más. El concepto clave aquí es “DNA sequence assembly”. En la Wikipedia en inglés lo cuentan más o menos bien:
            Yo en el laboratorio he utilizado mucho un programa llamado SeqMan para estas cosas, que es parte de un pack llamado DNA Star:

            ¡Un saludo!

            Me gusta

          3. hola Javier

            Soy Daniel de nuevo, muchiiiiisimas gracias por toda la aclaracion, y confirmar como opera este software bioinformatico. La explicacion es muy clara y es muy muy de agradecer las referencias a articulos tecnicos que incluyes. Llevo muchas horas de vuelo buscando e investigando por internet al respecto de la situacio en la que nos estamos viendo envueltos y tengo que decir sin lugar a dudas que tu sitio es el mas resolutivo que he encontrado.

            Un cordial saludo

            Le gusta a 1 persona

  4. Los postulados de Koch estan obsoletos una limitación es la existencia de patógenos que causan enfermedades diferentes de individuo en individuo y, también, enfermedades que se dan con la presencia de dos patógenos distintos, o incluso individuos que tienen el patógeno pero nunca manifestarán la enfermedad. en base a estas limitación ¿porque no utilizan la revisón de _Evans de los postulados de Koch?

    Me gusta

    1. Yo no se mucho de enfermedades infecciosas pero si se acepta que los postulados de Koch son obsoletos y no valen para la definicion de que es o no es un virus entonces habria que cambiar toda la literatura cientifica ya existente basada en los mismos. Vamos todo lo que se haya catalogado en funcion a los postulados de Koch habria de revisarse aplicar los nuevos y re-clasificar en base a resultados.

      Al igual que la cartografia y mapamundis tuvieron que cambiarse cuando se acepto que la tierra era redonda y no plana.

      No tengo la impresion de que haya un consenso cientifico pleno sobre si los postulados de Koch estan obsoletos.


      Me gusta

      1. No me parecen obsoletos los postulado de Koch, pero no aplica siempre, y se debe ampliar sus conceptos, es decir agregar las excepciones. No he leído lo de Evans

        Me gusta

      2. Esta muy bien hablar de Ciencia rigurosamente pero cuando se meten los cientificos en campos que no son suyos, derrapan. Me puede decir cuando se cambio se cambiaron la cartografía y los mapas-mundi por causa de la tierra redonda porque, que yo sepa, la eferidad de la tierra estaba y demostrada desde antes de Aristoteles y el primer mapa-mundi científico, el de Tolomeo, describe una tierra esférica y la proyecta al plano. Hasta los mapas O-T del medievo se basan en esto (prueba: ver los orbes de los reyes y vírgenes medievales) así como todos los geógrafos, fisicos, astrónomos y teólogos medievales. El principal problema e irresoluble, porque implica la cuadratura del círculo, es la representación plana de una superficie curva por lo que varía en el método de las proyecciones (de Mercator, Peters, etc.) Si anticuados son los postulados de Koch, más aún lo son las tesis de Draper sobre la historia de la ciencia.

        Me gusta

  5. Hola

    Sr Javier Canton

    Gracias por su trabajo divulgador. En tu articulo mencionas: “Uno de los argumentos utilizados provienen de este artículo, que identificó, en febrero de este 2020, al agente causante de unas neumonías atípicas en Wuhan.” La pregunta que nos hacemos muchos y quiza tu dispongas del conocimiento adquirido para aclararla es si este virus se identifico de la manera correcta. si en Efecto se purifico en su totalidad o si bien simplemente se encontraron partes de su genoma y estas se completaron con el uso de un sistema informatico para obtener la secuenciacion completa del genoma del virus.

    Un cordial saludo y gracias de nuevo

    Me gusta

  6. ¡Buenas Javier! En España el Centro Nacional de Microbiología realizó la secuenciación completa del SARS-CoV2 en muestras de pacientes de distintas partes de España. ¿Que sabes al respecto? Gracias por tu trabajo, ¡saludos!

    Me gusta

  7. Muchas gracias por abrir este debate,
    No me queda claro cual o cuales son los tests que cuantifican la cantidad de virus presentre en el organismo de forma directa y que por consecuencia podrian verificar la hipotesis que los asintomaticos tienen una carge viral menor que los sintomaticos o que los sintomaticos leves menor que los sintomaticos mas graves.
    Existen los TETS que detectan la repuesta inmunitaria como Elisa (el mas fiable) pero para deteccion de material génetico viral solo esta el RT-PCR, aunque sigue siendo une deteccion indirecta del material genetico del supuesto virus SRAS-COV2 tras extraccion y purification, osea que es une reconstruccion del material genetico del suspuesto virus puesto que se recompone la secuencia a partir de trozos y se convevierte en ADN.

    Da la impresion que la Cience a construido sus hiposesis sobre este patogeno de forma segmentada; por un lado el genoma sequenciado en Wuhan y otros centros (un virus de la familia del coronavirus un poco diferente de los 11.000 ya conocidos), por otro lado los tets con polymerasa PCR que purifican y recomponen las sequencias del material genético viral colmatando los trozos que faltan, y con esta mezcla ademas se añade la evidencia clinica de pacientes asintomaticos, ligeramente sintomaticos, muy sintomaticos y gravemente sintomaticos.

    En todo esto la logica de los principios de Koch debe tener su valor incluso actualmente, digo yo !.Si nos saltamos a la torera estos principios nos avos a cargar la “Evidence Base Medicine” en las enfermedades infecciosas, incluso la logica de la reconbinacion de variables en Médicina !!!

    Me gusta

  8. Enhorabuena Javier por tus enseñanzas. No sabía la existencia de esta web. Tu intención divulgativa y pedagógica que realizas con esta web es digna de mención. Pocos sitios encuentras a un eminente virólogo dando explicaciones a mortales como nosotros y en un lenguaje llano que entendamos todos/as.

    Al parecer hoy en día cualquiera puede poner en duda, con sus creencias, cualquier postulado, cualquier descubrimiento, cualquier estudio, etc sin tener idea de lo que se está hablando, simplemente diciendo que eso es mentira y argumentando que tú demuestres lo contrario. Hemos vuelto a la Edad Media, cuando te acusaban de bruja y tú tenías que demostrar tu inocencia.

    Aquellos negacionistas, en realidad, lo que deberían de hacer es todo lo contrario, demostrar con estudios publicados para que sean revisados por pares lo que dicen. De lo contrario, son creencias y opiniones que no interesan a nadie. Aquellos que quieran saber más y no caer en el estigma de “enterado”, decirle que las facultades están abierta para todo el mundo, que se matriculen, que estudien tal como han hecho señores como Javier.

    De nuevo Javier, enhorabuena por tu web.

    Me gusta

  9. El problema es que esos estudios, las herramientas utilizadas como el QIAamp Viral RNA Mini Kit y similares no aisla RNA de ningún virus separándolo de otros RNAs presentes en el cultivo. Lo que hace es purificar y separar el RNA de la muestra (todo el que haya) del resto de sustancias químicas (proteínas, lípidos…) presentes en el cultivo. Ese aislamiento es un no aislamiento. aparte de eso, se han saltado las recomendaciones de la NGS,

    Me gusta

  10. que se sabe de la validez de los cebadores, estan surgiendo noticias de que algunos de estos cebadores incluyen una secuencia presente en el ser humano :””

    Pero no solo eso sino que el laboratorio mas usado para la compra de sus PCR esta usando una cadena de nucleotidos como sequencia diana la cual la definieron antes de que el SARS-COV-2 se sequenciara por primera vez en Wuhan, lo publicase el British medical Journal y se incluyese esa secuencia en el genbank.


    Me gusta

    1. Pero no solo eso sino que el laboratorio mas usado para la compra de sus PCR esta usando una cadena de nucleotidos como sequencia diana la cual la definieron antes de que el SARS-COV-2 se sequenciara por primera vez en Wuhan, lo publicase el British medical Journal y se incluyese esa secuencia en el genbank.

      Tienes el origen de esa noticia?

      Me gusta

  11. Es posible tener una vacuna tan rápido. Pues tengo desde el 86 VIH y la medicación sin 700€al mes. Nunca necesite pues mis defensas estaban bien sin carga viral. Y como 1 año atrás me dicen de poner una medicación preventiva. Porque los cd4. Bajaron. No tome ni una pastilla pues muchos amigos an muerto por la medicacion. Y cuando fuy a revisión. Me dice el médico mira te fue bien la medicación ahora está todo bien. Y le deje el bote de pastillas en la mesa. Y le dije ya se donde no venir más. Tengo 55 años desde el 86 con esto se supone. Pues estoy bien de todo. Ahora miren los muertos por VIH. Y coño no sacan vacuna. Claro mientras paguen 700€ al mes. Negocio redondo. Unos hijos de. P como los médicos abortistas. Cual es su juramentó y que hacen abortos asta de 8 meses. Sin asesinos. Partes para trasplantes otras para cosméticos. Y luego las feministas. Que matan a sus niñas cuando tendrían que protegerlas. Donde coño bamos. A matarnos pues llegará cada día despertando más

    Me gusta

  12. “aislaron un virus en cultivos celulares, secuenciaron su genoma y vieron que pertenecía a la familia de los coronavirus.”

    NUNCA AISLARON, hicieron un modelo por computadora

    nunca una autopsia ya que no encontraran nada.

    Me gusta


Introduce tus datos o haz clic en un icono para iniciar sesión:

Logo de

Estás comentando usando tu cuenta de Cerrar sesión /  Cambiar )

Google photo

Estás comentando usando tu cuenta de Google. Cerrar sesión /  Cambiar )

Imagen de Twitter

Estás comentando usando tu cuenta de Twitter. Cerrar sesión /  Cambiar )

Foto de Facebook

Estás comentando usando tu cuenta de Facebook. Cerrar sesión /  Cambiar )

Conectando a %s

Crea tu sitio web con
Empieza ahora
A <span>%d</span> blogueros les gusta esto: